Skip Navigation

Bioscience Horizons 2008 1(1):51-60; doi:10.1093/biohorizons/hzn006
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by van Aartsen, J. J.
Right arrow Search for Related Content
PubMed
Right arrow Articles by van Aartsen, J. J.
Related Collections
Right arrow Cell Biology
Right arrow Genetics
Right arrow Medical Science
Right arrow Microbiology
Right arrow Molecular Biology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© Oxford University Press 2008

The Klebsiella pheV tRNA locus: a hotspot for integration of alien genomic islands

Jon Jurriaan van Aartsen*

Department of Infection Immunity and Inflammation, University of Leicester, Leicester, UK

* Corresponding author: Lab 212, Department of Infection Immunity and Inflammation, Maurice Shock Medical Sciences Building, University of Leicester, University Rd, Leicester LE1 9HN. Tel: +44 (0)116 2523056. Email: jjv1{at}le.ac.uk

Supervisor: Kumar Rajakumar, Department of Infection Immunity and Inflammation, University of Leicester, Leicester, UK.


    Abstract
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 Funding
 References
 
Klebsiella sp. cause a wide range of human infections, particularly nosocomial septicaemia, pneumonia and urinary tract infections. Like other Enterobacteriaceae, Klebsiella are likely to possess plastic genomes comprised of core regions interspersed with horizontally acquired genomic islands. As phenylalanine tRNA genes are known to be occupied by islands in other Enterobacteriaceae, we utilized PCR-based screening and chromosome walking techniques to examine the pheV locus in Klebsiella isolates from blood stream and urinary tract infections. We hypothesized that this gene was an integration hotspot that served as a repository for novel genetic material in Klebsiella. The pheV site in Klebsiella KR116 and KR164 harboured an islet encoding four genes, two with similarity to genes within an island downstream of pheR in Salmonella enterica serovar Typhi CT18. In KR173 the locus contained a larger, potentially intact version of this island and harboured an integrase gene similar to that in the S. Typhi CT18 island. However, the Klebsiella and Salmonella islands were clearly distinguishable by strain-specific segments and organizational variation. On the basis of available sequence and restriction fragment length polymorphism data, three other Klebsiella isolates were found to possess an entirely distinct entity that resembled a 12.6 kb pheV associated island in K. pneumoniae MGH78578. This island was predicted to encode a P pilus-like structure, a probable virulence factor on the basis of parallels with E. coli. A unique and intriguing feature of Klebsiella pheV loci was the presence of multiple tandem repeats of up to 163 bp immediately downstream of pheV and a truncated copy at the opposite end of the islands. The tRNA proximal repeats were variable in number and size between isolates, while the solitary downstream repeats varied in length. These elements may represent genetic debris of previous recombination events. In conclusion, the pheV locus of Klebsiella exhibited considerable variability between strains and harboured at least two distinct island types that could play important roles in adaptation and/or virulence. Functional characterization of this genetic armory will help unravel basic microbial and pathogenesis processes and may in time lead to improvements in the diagnosis, prevention and treatment of Klebsiella infections.

Key words: Klebsiella, phenylalanine, tRNA, genomic island, pathogenicity island, genome plasticity


    Introduction
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 Funding
 References
 
The Klebsiella genus contains a diverse group of commensal and pathogenic species. K. pneumoniae and K. oxytoca are the most frequently implicated species in nosocomial and community acquired Klebsiella infections, which include pneumonia, septicaemia, urinary tract infections and wound infections.1, 2

Bacterial genomes consist of two parts: the core and flexible genome. The core genome is shared by nearly all strains of the same species and encodes proteins involved in basic cellular function. The remainder is the flexible genome, a highly variable complement of strain-specific genes.3 Genome variability plays an important role in the evolution and adaptive ability of bacteria, allowing for loss and/or acquisition of functions via mutational changes or horizontal gene transfer.4, 5 The flexible genome often harbours segments of recognizable mobile genetic elements, such as transposons, phages, plasmids and archetypal integrative genomic islands, that may confer enhanced antibiotic resistance, pathogenicity or ecological fitness.6

tRNA loci commonly serve as insertion sites for mobile elements as they are highly conserved between bacteria and thus allow for a greater degree of promiscuous movement.7, 8 The phe tRNA genes in several members of the Enterobacteriaceae family have been found to harbour pathogenicity islands, large 10 to 200 kb clusters of strain-specific genes some of which confer defined virulence traits.9, 10 The pheV locus of uropathogenic E. coli strain J96 contains a 170 kb island (PAI IJ96) that encodes a P pilus, an essential virulence factor in pyelonephritis.11, 12 In enteropathogenic E. coli this same locus is occupied by the LEE pathogenicity island that is crucial for the attachment and effacing phenotype responsible for much of the resulting pathology.8 Similarly, the pheV locus of S. flexneri serotype 2a is occupied by the she island which encodes multiple genes involved in Shigella pathogenesis.1315 Additionally, a large-scale analysis of sequenced genomes using the Islander algorithm, which searches the genome for potential islands next to tRNA sites bordered by direct repeats and containing an integrase gene, has also identified phenylalanine tRNA genes as insertion ‘hotspots’ in several other bacteria.16 These findings were confirmed by tRNAcc, an algorithm that evaluates the content and context of tRNA and tmRNA genes across two or more genomes by identifying the conserved segments that flank potential island integration sites.17

Although much effort has been focused on identifying E. coli, Salmonella and Shigella genomic islands, little is known about the Klebsiella flexible genome and its constituent islands, as only one Klebsiella genome, that of K. pneumoniae MGH78578, has been sequenced completely to date. On the basis that pheV is a known integration target in other Enterobacteriaceae and assuming that genomic islands move at low frequency between bacteria sharing an ecological niche and that once acquired integrate at the same locus through site-specific recombination, we targeted Klebsiella phenylalanine tRNA loci, equivalent to that at 3.72 Mb in K. pneumoniae MGH78578 which we have termed pheV, for investigation. We aimed to identify novel islands, uncover likely horizontal gene transfer events and explore the genome plasticity of Klebsiella. Specifically, by targeting clinical Klebsiella isolates we hoped to discover pathogenicity islands bearing novel virulence genes, which could potentially be harnessed as targets for a new generation of pathotype-specific diagnostic tools, prophylactic measures and/or therapeutics strategies.


    Material and methods
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 Funding
 References
 
Bacterial strains, plasmids and media
Bacterial strains and plasmids used in this study are listed in Table 1. Clinical Klebsiella isolates were obtained from blood and urine cultures at Leicester Royal Infirmary and stored in –20°C/ – 80°C glycerol stocks. Strains were grown at 37°C in LB medium or LB agar, supplemented with ampicillin (100 µg ml–1) or kanamycin (50 µg ml–1) when required.


View this table:
[in this window]
[in a new window]

 
Table 1. Bacterial strains and plasmids used

 
Preparation and manipulation of DNA
Genomic DNA was isolated by a modified phenol/chloroform extraction protocol.18 Plasmid DNA was prepared by standard alkaline lysis.18, 19 Restriction enzymes (Roche Diagnostics) and T4 DNA ligase (Promega) were used according to manufacturer's instructions. Genomic libraries were constructed by overnight ligation of digested genomic DNA to appropriately digested pBluescriptII KS + . Chemically competent E. coli DH5{alpha} were prepared and transformed according to standard methods. Standard subcloning methods were utilized.18

tRNAcc analysis and PCR primer design
tRNAcc was run using default parameters.17, 20 87 tRNA loci from K. pneumoniae MGH78578 were mapped to homologous tRNA loci in K. pneumoniae Kp342, a partially sequenced genome. Subsequently, the tRNAcc subprogram ExtractFlank was used to obtain and align 2 kb upstream and downstream conserved flanking regions corresponding to these tRNA loci from both genomes. Genomic islands were identified as non-homologous regions lying between conserved upstream and downstream flanks. Primers to amplify across the pheV locus, 55pheU (CGTGCTTTTAGCGCAATGT) and 55pheD (GACATAACCATTTACCCACTCGT), were designed using the upstream and downstream pheV flanking consensus sequences, respectively (M. Patel and H.Y. Ou, personal communication).

tRIP PCR, SGSP PCR reactions and sequencing
tRIP PCR (tRNA site interrogation for pathogenicity islands, prophages and other genomic islands PCR) reactions were performed in a volume of 20 µl using 1.25 U GoTaq® DNA polymerase (Promega), 0.4 µl of 10.0 mM dNTP, 20 pmol of primers 55 pheU and 55 pheD, and 10 ng of genomic DNA as template. Cycling conditions comprised 30 cycles of 30 s at 95.0°C, 30 s at 59.0°C and 3 min at 72.0°C. SGSP PCR (single genome specific primer PCR) was performed similarly, but used genomic libraries based on five distinct restriction enzymes (EcoRI, BamHI, PstI, HindIII, HincII) as template instead. Additionally, either the primer 55 pheU or 55 pheD was used in conjunction with a vector specific primer (T3 or T7) to amplify the island extremities adjacent to the upstream and downstream conserved flanks, respectively. SGSP PCR cycling conditions when using T7 comprised an initial 10 cycles of 30 s at 95.0°C, 30 s at 67.4°C (decreased by 1°C each cycle) and 4 min at 72.0°C. This was followed by 20 cycles of 30 s at 95.0°C, 30 s at 57.4°C and 4 min at 72.0°C. When using T3 the annealing temperatures of 67.4°C and 57.4°C were decreased to 63.0°C and 53.0°C, respectively. PCR amplicons were gel purified using the DNA Spin Gel Extraction /PCR DNA purification kit (Yorkshire Bioscience) and DNA sequencing was performed by MWG Biotech.

Sequence analysis
Both local and online databases were searched for nucleotide and amino acid similarities using Blastn, Blastp, Blastx, tBlastn and tBlastx.21 The MobilomeFINDER20 and Islander16 databases were explored to identify whether similarity hits occurred within known genomic islands. Protein coding sequence (CDS) prediction was performed using Glimmer 3.0222 and CDD identified protein domains.23 Tandem Repeat Finder24 and Blastn were used to localize upstream and downstream repeats, respectively. Repeat nucleotide sequences were aligned using ClustalX with default parameters.25


    Results
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 Funding
 References
 
Interrogation of pheV loci in KR116 and KR164 reveals a novel genomic islet
Ten of 16 Klebsiella strains produced pheV tRIP PCR amplicons of 0.5 kb, confirming these loci were unoccupied. Four strains (KR162, KR163, KR169 and KR173) produced no tRIP PCR amplicon and two (KR116 and KR164) yielded an ~3.7 kb product.

KR116_pheV, the amplicon corresponding to the KR116 pheV site, was ligated into pCR4-TOPO® (Invitrogen) and subcloned into pWSK12926 for sequencing. Sequence analysis revealed that this segment harboured four predicted CDS and was novel to Klebsiella (Fig. 1). KR116_pheV_1 coded for a 51 amino acid (aa) protein with high homology to part of a non-functional putative transposase in Yersinia pestis. The second CDS, KR116_pheV_2, was predicted to encode a novel 181aa protein with no Blastn, tBlastn or Blastp matches and no conserved domains. The protein encoded by KR116_pheV_3 (174aa) strongly matched a putative acetyltransferase in Salmonella enterica Typhi CT18, an association supported by the detection of a Gcn5 related N-acetyltransferase (GNAT) domain at the protein's amino terminus. KR116_pheV_4 was predicted to encode a 79aa protein that harboured a truncated version of a domain of unknown function present in a S. Typhi CT18 hypothetical protein. Interestingly, the two corresponding S. Typhi CT18 genes were themselves located within a 133.7 kb pheR associated genomic island (H.Y. Ou, personal communication). The matching region of the Klebsiella islet had 85% nucleotide identity to the S. Typhi CT18 island. Sample sequencing of the KR164 pheV islet revealed ≥96% nucleotide sequence identity to that of KR116, strongly suggesting that the two strains harboured near identical islets at this genomic location.


Figure 1
View larger version (8K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. An outline of the novel ~3.7 kb Klebsiella genomic islet present at the KR116 and KR164 pheV loci with predicted CDS and Blastp similarity hits. The grey rectangle highlights the full conserved domain of unknown function in the S. Typhi CT18 hypothetical protein homolog of KR116_pheV_4. UF, conserved upstream flank; DF, conserved downstream flank; DR, direct repeat; I, identity; E, expect value.

 
KR173 harbours a large integrase bearing element within the pheV locus
SGSP PCR amplicons produced using as template EcoRI (~2.7 kb), HindIII (~1.5 kb) and BamHI (~1.3 kb) genomic libraries of KR173 were selectively sequenced to chromosome walk into the putative island integrated into the KR173 pheV gene (Fig. 2). Blastn revealed that the defined portions of the upstream arm (UA) of the KR173 island had high homology to corresponding regions of the pheR island in S. Typhi CT18, the same island mentioned previously in relation to the KR116 and KR164 islets. This region of the Salmonella island encoded a P4 integrase that had 93–99% aa identity to the matching predicted KR173 protein. However, the minor size discrepancy between these regions suggested a possible short insertion within the KR173 integrase gene (Fig. 2). Additionally, in KR173 there was a small 270 bp UA segment which did not match the Salmonella island and was predicted to encode a hypothetical protein that lacked Blastp homologs. The last 172 bp of the KR173 UA matched the S. Typhi CT18 island ~2 kb further downstream of the integrase bearing Blastn hit.


Figure 2
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. The genetic organization of the KR173 pheV locus genomic island and its associated Blast similarity hits in KR116 and S. Typhi CT18. UF, conserved upstream flank; DF, conserved downstream flank; DR, direct repeat; I, identity; E, expect value.

 
The first ~1.4 kb of the KR173 pheV island DA matched an equivalent region in KR116; approximately 900 bp of this common region, which encoded two hypothetical proteins, exhibited strong similarity to a portion of island DNA 12.1 kb downstream of pheR in S. Typhi CT18. However, unlike KR116_pheV_4, the slightly larger KR173 homolog, like that of Salmonella, was predicted to encode the full domain of unknown function. Nucleotide sequence from further within the KR173 island did not exhibit DNA matches to KR116_pheV, S. Typhi CT18 or other Genbank entries. The sequence was predicted to code for a 303aa hypothetical protein with a very low homology Blastp hit to a Lactococcus lactis cremoris MG1363 protein; there were no conserved domains identified.

Restriction pattern similarities at three loci: a prevalent Klebsiella island coding for type 1 pili?
Three tRIP PCR negative strains (KR162, KR163 and KR169) that potentially harboured elements at the pheV site produced comparable restriction patterns with SGSP PCR. Chromosome walking into the UA produced ~3.5 kb and ~2.1 kb fragments with BamHI and PstI genomic libraries, respectively. Similarly, DA analysis using PstI libraries produced ~1.8 kb fragments, while the use of EcoRI libraries generated ~4.0 kb products. In silico SGSP PCR analysis on the K. pneumoniae MGH78578 genome revealed the amplicon sizes from the three test strains matched those expected from K. pneumoniae MGH78578, which harboured a 12.6 kb genomic island immediately downstream of the pheV gene. In total, ten SGSP PCR products representative of the three test strains were sequenced and confirmed to have very high nucleotide homology (≥95%) to that of the MGH78578 island. The only major discrepancy was an extra 163 bp repeat in MGH78578 (see in what follows).

The sequence data and restriction patterns confirmed that at least 7.5 kb of the 12.6 kb MGH78578 island was present in all three test strains (Fig. 3 and Table 2). KPN_03400 putatively coded for a full length (397aa) P4 integrase, with 67% amino acid identity to an Enterobacter sp. 638 integrase. KPN_03401 to KPN_03403 and KPN_03406 had low identity (39–53%) to protein homologs in Yersinia frederiksenii ATCC33641 that were deduced to code for subunits of a P pilus system, a type 1 pilus involved in adhesion.27, 28 Analysis of the Y. frederiksenii chromosome showed that the putative P pilus genes were positioned in tandem with each other and in the same order as in K. pneumoniae MGH78578. Additionally, these genes were located ~5 kb downstream of a lambda like integrase, suggesting that the Yersinia counterparts were also part of a larger acquired island. KP_03407 putatively encoded a hypothetical protein. The presence of a similar gene in a second related but quite distinct cluster suggested that these homologues may play a role in fimbrial biogenesis as well. In MGH78578, the P pilus cluster was interrupted by the insertion of two near identical tandem genes, KPN_03404 and KPN_03405, whose products had 28–31% homology to the Yersinia intermedia ATC29909 FimA protein, further supporting the hypothesis that these genes code for a novel Klebsiella fimbrial appendage.


Figure 3
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3. An illustration of genes present on the K. pneumoniae MGH78578 pheV island. The areas of the island that have been confirmed to occur in KR162, KR163 and/or KR169 by sequence data and/or SGSP PCR restriction patterns are depicted at the top of the diagram. Details of the products encoded for by each of the labelled island genes are found in Table 2. The Yersinia frederiksenii ATC33641 Blastp homologs are pictured in the order that they appear on the genome; they are positioned in tandem and in the same order as in MGH78578. However, in MGH78578 this structure is interrupted by KPN_03404 and KPN_03405. PapD1, PapD2 and PapD3 correspond to three distinct PapD proteins that share a high level of sequence similarity. UF, conserved upstream flank; DF, conserved downstream flank.

 


View this table:
[in this window]
[in a new window]

 
Table 2. Genes present on an island downstream of pheV in K. pneumoniae MGH78578

 
Variable tandem repeats downstream of pheV tRNA genes
Analyses of DNA sequences from various K. pneumoniae pheV loci revealed multiple repeats existed immediately downstream of the tRNA gene in the majority of strains analysed and that a solitary repeat sequence often lay within the opposite end of the island as well (Fig. 4).


Figure 4
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4. A diagram comparing the repeats present in the upstream and downstream extremities of elements present at the pheV locus in six Klebsiella strains. The full length repeat unit was identified to be a 163 bp sequence that started with 18 bp of the 3' end of pheV. Downstream repeats bore much nucleotide similarity to the repeat unit, although they were much shorter and occurred as isolated units. URx indicates upstream direct repeat number x. DRx represents downstream direct repeat number x. The triangles represent the area of the direct repeat that corresponds to the 3' terminus of pheV. UF, conserved upstream flank; DF, conserved downstream flank.

 
The typical full length repeat unit was identified as a 163 bp sequence that started with 18 bp of the 3' terminus of pheV. ClustalX alignment of the full set of identified repeats revealed that, with the exception of Kp342_UR3, all UA repeat segments in this six strain panel exhibited limited nucleotide variation and were highly homologous (Fig. 5). KR310 possessed an empty pheV site and only had a single 81 bp truncated repeat sequence. In contrast, Kp342 also had an empty site but possessed a three repeat sequence of 386 bp in total. Furthermore, even though KR173 harboured the large novel island identified in this study it lacked any recognizable upstream repeats, perhaps with the exception of the 18 bp 3' terminus of its pheV gene. These observations suggested that the UA repeat number did not correlate with the size or type of island integrated at the pheV locus.


Figure 5
View larger version (86K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5. A ClustalX alignment of all the direct repeats found at the pheV loci of six Klebsiella strains and illustrated in Fig. 4. Using KR116_UR1 as the reference unit, identical bases in other repeats were shaded grey. The alignment revealed that all upstream arm repeats in this panel of strains, except Kp342_UR3, exhibited limited nucleotide variation and were highly homologous. The repeats have been labelled STRAIN_URX or STRAIN_DRX, where URX denotes upstream direct repeat number X and DRX represents downstream direct repeat number X.

 
The solitary DA repeats that were found also possessed strong nucleotide similarity to the 163 bp consensus sequence, although they were much shorter than their UA counterparts. In KR116 and KR173, the downstream repeats contained 17 bp of the 3' end of pheV and continued with a further 63–69 bp of repeat sequence; those in KR162 and MGH78578 did not contain any pheV sequence at all and were even shorter in length. KR310 and Kp342 did not possess any downstream repeats. Additionally, none of the DA repeats lay at the very extremity of the island arm, as identified based on the boundary with highly conserved downstream flanking core genome. Between 67 and 74 bp separated the single DA repeat and the predicted core genome. However, this could have been an artefact resulting from incorrect island/flank boundary determination by comparative genome analysis. This is known to occur particularly when only two input genomes are used for tRNAcc analysis, as was the case in this study.17


    Discussion
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 Funding
 References
 
Genome plasticity is of major importance in bacterial evolution and has frequently been associated with intraspecies phenotype variation.4 This paper has provided strong evidence that the Klebsiella pheV tRNA gene is an island integration hotspot. The presence of these elements gives rise to a variable genomic region that serves as a repository for novel genes. Of the 16 strains investigated, six were found to harbour one of three different islands within their pheV locus. Two entities, one potentially being a markedly truncated version of the other, were entirely novel to Klebsiella. The discovery of several islands at this locus was in perfect agreement with our hypothesis and with the findings of Germon et al. who reported frequent occupation of the E. coli pheV locus.9 Similarly, the presence within these elements of previously undiscovered DNA sequences was consistent with the report by Hsiao et al.29 who observed that novel bacterial genes were commonly localized to genomic islands.

KR116_pheV_3 was predicted to code for a hypothetical protein harbouring a GNAT domain, a signature motif of an enzyme superfamily widely distributed in all kingdoms.30 One group of GNAT proteins, the aminoglycoside transferases, chemically modify aminoglycosides, thus resulting in resistance to members of this class of antimicrobials.30 However, preliminary antibiotic susceptibility assays performed on KR116 have failed to show an increase in resistance to gentamicin or kanamycin (J.J.v.A., unpublished data) alluding to a possible alternative function for KR116_pheV_3. A second group of GNAT enzymes, represented by the E. coli GlmU protein, function as glucosamine-6-phosphate N-acetyltransferases. GlmU produces UDP-N-acetylglucosamine, an essential precursor of two biofilm components: peptidoglycans and lipopolysaccharides.31 In Klebsiella urinary tract and respiratory tract infections, the ability to form biofilms on abiotic surfaces is of recognized importance.32 Inhibition of GlmU reduces biofilm formation and bacterial colonization, and hence pathogenicity,31 raising the intriguing possibility that KR116_pheV_3 may play a direct role in virulence. Nevertheless, bioinformatics analysis alone could not attribute a specific function to KR116_pheV_3. However, given that this gene is located within the potentially unstable flexible genome of multiple strains, it is likely that it is being retained as a consequence of selection pressure that arises from its yet to be defined biological role.

The KR173 pheV island is likely to be an example of a cross genus lateral transfer event. Both the Salmonella and Klebsiella islands encoded a putative P4-related integrase, a type of enzyme which has been experimentally determined to control island excision and integration. Island encoded integrases are widely regarded as playing an essential role in horizontal island transfer events and genomic island evolution.33 The high level of nucleotide similarity of the terminal regions of both islands and their presence within phenylalanine tRNA genes in two distinct hosts, further substantiates the idea of inter genus movement. Additionally, the Klebsiella pheV and Salmonella pheR genes possess an identical nucleotide sequence,7 thus providing an identical substrate for the two integrases during site-specific recombination. We hypothesize that these elements arose from a common island ancestor present within the wider gene pool shared by Salmonella and Klebsiella. Over time, each island has differentiated and evolved independently as a function of the different environmental and host-derived selection pressures that are exerted on these two types of bacteria. The available evidence also suggests that the KR116/KR164 islet represents a remnant of the larger KR173 pheV island that has resulted from an imprecise excision or deletion event; similar phenomena affecting other genomic islands have been reported previously.34

A 12.6 kb pheV island was identified in K. pneumoniae MGH78578 and although it harboured a large cluster of genes encoding P pilus subunits, including PapD, PapC and FimA, it did not appear to encode all subunits.35 P pili are essential virulence factors in E. coli that cause pyelonephritis,11 raising the prospect that the island may contribute to disease causation. The consequences of an incomplete set of P pilus subunits on the bacterial phenotype remains to be tested, but it must be noted that the ‘missing’ subunits may be coded for elsewhere on the genome. Additionally, multiple genes putatively encoded the same or closely related subunits. The incentive for maintaining this level of apparent redundancy is unknown, but may involve increased ability to evade the immune system by varying antigens presented on the cell surface.36 Apart from an extra 163 bp repeat, the extremities of the MGH78578 pheV island were almost identical to pheV associated islands in KR162, KR163 and KR169. However, it is quite possible that repeat structure variation may be indicative of significant divergence further within a genomic island, an area hidden from our current interrogation tools. Future studies using a yeast recombinational island capture system will be invaluable in addressing this matter.20, 37

A unique and intriguing feature of Klebsiella pheV loci was the presence of multiple tandem repeats. With the exception of tandem insertion sequence elements, the E. coli LEE pathogenicity island is the only other island described as harbouring terminally located, large, directly oriented repeats (136 bp).7, 38 The presence of other repeat motifs elsewhere in the Klebsiella genomes remains to be determined, though the pheV 163 bp repeat sequence is specific to this particular locus. The differing numbers of UA repeats is reminiscent of many other variable number tandem repeat (VNTR) loci that have been described in bacteria;3942 these are thought to originate from slipped strand mispairing or recombination events.43 It is widely accepted that some VNTR loci can affect phase variation, either by modifying promoters that modulate transcription or by altering protein amino acid sequence. Generally, however, variations in a large proportion of VNTR do not cause observable phenotype changes and are believed to simply constitute scars of erroneous DNA replication.42, 44 Given that the pheV repeats do not lie within or in close proximity to recognizable CDS, these repeats could well fall into the latter group. Alternatively, similar to the attL/attR sites that flank integrated prophages, the repeats may have arisen from a succession of previous imprecise island insertion and/or deletion events.45 This is supported by the finding that most of the Klebsiella pheV repeats that we found exhibited high level similarity to the 3' end of pheV, the target sequence for island insertion itself. The Klebsiella pheV repeats appear to be an isolated phenomenon in the broader genomic island story and may provide new clues about island development, evolution and/or functional orchestration. Alternatively, these repeats may serve as a novel target for enhanced Klebsiella molecular typing.46

The data presented here contributes to the complex and evolving story of bacterial genome plasticity and clearly places Klebsiella among the growing list of bacteria exhibiting a high degree of intra species genome diversity. Given parallels with fellow Enterobacteriaeceae, E. coli, Shigella, Salmonella and Yersinia, 8, 4, 33, 4749 it is very likely that the discovery and characterization of Klebsiella islands will be central to defining the detailed mechanisms of pathogenesis utilized by this important human pathogen. In light of increasing antimicrobial resistance, a comprehensive understanding of the genes, proteins and molecular events involved in pathogen survival, transmission and disease causation is essential if we are to develop a new generation of therapeutic, prognostic and diagnostic tools. Indeed this is likely to be crucial if we are to continue to successfully manage both community-acquired and nosocomial infections well into the future.


    Funding
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 Funding
 References
 
The author was supported by a Wolfson Foundation Award Intercalated BSc Studentship.


    Acknowledgements
 
We thank Hong-Yu Ou for his assistance and support with tRNAcc. We thank Dr Peter Munthali for providing the clinical Klebsiella strains from the Leicester Royal Infirmary, and James Lonnen, Ewan Harrison and Mansi Patel for laying the foundations on which this work was started. We also thank the Institute for Genomic Research (TIGR) and Washington University in St Louis for their policy of making preliminary sequence data publicly available and acknowledge the use in this study of unpublished genome data corresponding to Kp342 and MGH78578, respectively.


    References
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 Funding
 References
 

  1. Podschun R, Pietsch S, Holler C, et al. Incidence of Klebsiella species in surface waters and their expression of virulence factors. Appl Environ Microbiol (2001) 67:3325–3327.[Abstract/Free Full Text]
  2. Podschun R, Ullmann U. Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin Microbiol Rev (1998) 11:589–603.[Abstract/Free Full Text]
  3. Medini D, Donati C, Tettelin H, et al. The microbial pan-genome. Curr Opin Genet Dev (2005) 15:589–594.[CrossRef][Web of Science][Medline]
  4. Dobrindt U, Hacker J. Whole genome plasticity in pathogenic bacteria. Curr Opin Microbiol (2001) 4:550–557.[CrossRef][Web of Science][Medline]
  5. Hacker J, Carniel E. Ecological fitness, genomic islands and bacterial pathogenicity. A Darwinian view of the evolution of microbes. EMBO Rep (2001) 2:376–381.[Web of Science][Medline]
  6. Frost LS, Leplae R, Summers AO, et al. Mobile genetic elements: the agents of open source evolution. Nat Rev Microbiol (2005) 3:722–732.[CrossRef][Web of Science][Medline]
  7. Hacker J, Kaper JB. Pathogenicity islands and the evolution of microbes. Ann Rev Microbiol (2000) 54:641–679.[CrossRef][Web of Science][Medline]
  8. Schmidt H, Hensel M. Pathogenicity islands in bacterial pathogenesis. Clin Microbiol Rev (2004) 17:14–56.[Abstract/Free Full Text]
  9. Germon P, Roche D, Melo S, et al. tDNA locus polymorphism and ecto-chromosomal DNA insertion hot-spots are related to the phylogenetic group of Escherichia coli strains. Microbiology (2007) 153:826–837.[Abstract/Free Full Text]
  10. Hou YM. Transfer RNAs and pathogenicity islands. Trends Biochem Sci (1999) 24:295–298.[CrossRef][Web of Science][Medline]
  11. Mu XQ, Bullitt E. Structure and assembly of P-pili: a protruding hinge region used for assembly of a bacterial adhesion filament. Proc Natl Acad Sci USA (2006) 103:9861–9866.[Abstract/Free Full Text]
  12. Swenson DL, Bukanov NO, Berg DE, et al. Two pathogenicity islands in uropathogenic Escherichia coli J96: cosmid cloning and sample sequencing. Infect Immun (1996) 64:3736–3743.[Abstract]
  13. Rajakumar K, Sasakawa C, Adler B. Use of a novel approach, termed island probing, identifies the Shigella flexneri she pathogenicity island which encodes a homolog of the immunoglobulin A protease-like family of proteins. Infect Immun (1997) 65:4606–4614.[Abstract]
  14. Al-Hasani K, Henderson IR, Sakellaris H, et al. The sigA gene which is borne on the she pathogenicity island of Shigella flexneri 2a encodes an exported cytopathic protease involved in intestinal fluid accumulation. Infect Immun (2000) 68:2457–2463.[Abstract/Free Full Text]
  15. Al-Hasani K, Adler B, Rajakumar K, et al. Distribution and structural variation of the she pathogenicity island in enteric bacterial pathogens. J Med Microbiol (2001) 50:780–786.[Abstract/Free Full Text]
  16. Mantri Y, Williams KP. Islander: a database of integrative islands in prokaryotic genomes, the associatedintegrases and their DNA site specificities. Nucleic Acids Res (2004) 32:D55–D58.[Abstract/Free Full Text]
  17. Ou HY, Chen LL, Lonnen J, et al. A novel strategy for the identification of genomic islands by comparative analysis of the contents and contexts of tRNA sites in closely related bacteria. Nucleic Acids Res (2006) 34:e3.[Abstract/Free Full Text]
  18. Ausubel FM. Current protocols in molecular biology. (1987) New York: Wiley.
  19. Morelle G. A plasmid extraction procedure on a miniprep scale. Focus (1989) 11:7–8.
  20. Ou HY, He X, Harrison EM, et al. MobilomeFINDER: web-based tools for in silico and experimental discovery of bacterial genomic islands. Nucleic Acids Res (2007) 35:W97–W104.[Abstract/Free Full Text]
  21. Altschul SF, Madden TL, Schaffer AA, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res (1997) 25:3389–3402.[Abstract/Free Full Text]
  22. Delcher AL, Bratke KA, Powers EC, et al. Identifying bacterial genes and endosymbiont DNA with Glimmer. Bioinformatics (2007) 23:673–679.[Abstract/Free Full Text]
  23. Marchler-Bauer A, Anderson JB, Derbyshire MK, et al. CDD: a conserved domain database for interactive domain family analysis. Nucleic Acids Res (2007) 35:D237–D240.[Abstract/Free Full Text]
  24. Benson G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res (1999) 27:573–580.[Abstract/Free Full Text]
  25. Chenna R, Sugawara H, Koike T, et al. Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res (1999) 31:3497–3500.[CrossRef]
  26. Wang RF, Kushner SR. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene. (1991) 100:195–199.
  27. Roberts JA, Marklund BI, Ilver D, et al. The Gal(alpha 1-4)Gal-specific tip adhesin of Escherichia coli P-fimbriae is needed for pyelonephritis to occur in the normal urinary tract. Proc Natl Acad Sci USA (1994) 91:11889–11893.[Abstract/Free Full Text]
  28. Lane MC, Mobley HL. Role of P-fimbrial-mediated adherence in pyelonephritis and persistence of uropathogenic Escherichia coli (UPEC) in the mammalian kidney. Kidney Int (2007) 72:19–25.[CrossRef][Web of Science][Medline]
  29. Hsiao WW, Ung K, Aeschliman D, et al. Evidence of a large novel gene pool associated with prokaryotic genomic islands. PLoS Genet (2005) 1:e62.[CrossRef][Medline]
  30. Vetting MW, LP SdC, Yu M, et al. Structure and functions of the GNAT superfamily of acetyltransferases. Arch Biochem Biophys (2005) 433:212–226.[CrossRef][Web of Science][Medline]
  31. Burton E, Gawande PV, Yakandawala N, et al. Antibiofilm activity of GlmU enzyme inhibitors against catheter-associated uropathogens. Antimicrob Agents Chemother (2006) 50:1835–1840.[Abstract/Free Full Text]
  32. Boddicker JD, Anderson RA, Jagnow J, et al. Signature-tagged mutagenesis of Klebsiella pneumoniae to identify genes that influence biofilm formation on extracellular matrix material. Infect Immun (2006) 74:4590–4597.[Abstract/Free Full Text]
  33. Hochhut B, Wilde C, Balling G, et al. Role of pathogenicity island-associated integrases in the genome plasticity of uropathogenic Escherichia coli strain 536. Mol Microbiol (2006) 61:584–595.[CrossRef][Web of Science][Medline]
  34. Turner SA, Luck SN, Sakellaris H, et al. Nested deletions of the SRL pathogenicity island of Shigella flexneri 2a. J Bacteriol (2001) 183:5535–5543.[Abstract/Free Full Text]
  35. Soto GE, Hultgren SJ. Bacterial adhesins: common themes and variations in architecture and assembly. J Bacteriol (1999) 181:1059–1071.[Free Full Text]
  36. van der Woude MW, Baumler AJ. Phase and antigenic variation in bacteria. Clin Microbiol Rev (2004) 17:581–611. table of contents.[Abstract/Free Full Text]
  37. Wolfgang MC, Kulasekara BR, Liang X, et al. Conservation of genome content and virulence determinants among clinical and environmental isolates of Pseudomonas aeruginosa. Proc Natl Acad Sci USA (2003) 100:8484–8489.[Abstract/Free Full Text]
  38. Muniesa M, Schembri MA, Hauf N, et al. Active genetic elements present in the locus of enterocyte effacement in Escherichia coli O26 and their role in mobility. Infect Immun (2006) 74:4190–4199.[Abstract/Free Full Text]
  39. Liu Y, Lee MA, Ooi EE, et al. Molecular typing of Salmonella enterica serovar typhi isolates from various countries in Asia by a multiplex PCR assay on variable-number tandem repeats. J Clin Microbiol (2003) 41:4388–4394.[Abstract/Free Full Text]
  40. van der Zanden AG, Hoentjen AH, Heilmann FG, et al. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis complex in paraffin wax embedded tissues and in stained microscopic preparations. Mol Pathol (1998) 51:209–214.[Abstract]
  41. Lindstedt BA, Brandal LT, Aas L, et al. Study of polymorphic variable-number of tandem repeats loci in the ECOR collection and in a set of pathogenic Escherichia coli and Shigella isolates for use in a genotyping assay. J Microbiol Methods (2007) 69:197–205.[CrossRef][Web of Science][Medline]
  42. van Belkum A, Scherer S, van Alphen L, et al. Short-sequence DNA repeats in prokaryotic genomes. Microbiol Mol Biol Rev (1998) 62:275–293.[Abstract/Free Full Text]
  43. Achaz G, Rocha EP, Netter P, et al. Origin and fate of repeats in bacteria. Nucleic Acids Res (2002) 30:2987–2994.[Abstract/Free Full Text]
  44. Vogler AJ, Keys C, Nemoto Y, et al. Effect of repeat copy number on variable-number tandem repeat mutations in Escherichia coli O157:H7. J Bacteriol (2006) 188:4253–4263.[Abstract/Free Full Text]
  45. Reiter WD, Palm P, Yeats S. Transfer RNA genes frequently serve as integration sites for prokaryotic genetic elements. Nucleic Acids Res (1989) 17:1907–1914.[Abstract/Free Full Text]
  46. van Belkum A. Tracing isolates of bacterial species by multilocus variable number of tandem repeat analysis (MLVA). FEMS Immunol Med Microbiol (2007) 49:22–27.[CrossRef][Web of Science][Medline]
  47. Carniel E. The Yersinia high-pathogenicity island: an iron-uptake island. Microbes Infect (2001) 3:561–569.[CrossRef][Web of Science][Medline]
  48. Morgan E, Bowen AJ, Carnell SC, et al. SiiE is secreted by the Salmonella enterica serovar Typhimurium pathogenicity island 4-encoded secretion system and contributes to intestinal colonization in cattle. Infect Immun (2007) 75:1524–1533.[Abstract/Free Full Text]
  49. Nougayrede JP, Homburg S, Taieb F, et al. Escherichia coli induces DNA double-strand breaks in eukaryotic cells. Science (2006) 313:848–851.[Abstract/Free Full Text]
  50. Alting-Mees MA, Sorge JA, Short JM. pBluescriptII: multifunctional cloning and mapping vectors. Methods Enzymol (1992) 216:483–495.[Web of Science][Medline]
Submitted on 27 September 2007; accepted on 17 December 2007


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by van Aartsen, J. J.
Right arrow Search for Related Content
PubMed
Right arrow Articles by van Aartsen, J. J.
Related Collections
Right arrow Cell Biology
Right arrow Genetics
Right arrow Medical Science
Right arrow Microbiology
Right arrow Molecular Biology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?